Journal of Virological Methods128(2005)

54–60

A new combination of RT-PCR and reverse dot blot hybridization for

rapid detection and identification of potyviruses

Yueh-Chwen Hsu,Tzu-Jung Yeh,Ya-Chun Chang∗

Department of Plant Pathology and Microbiology,National Taiwan University,No.1,Sec.4,Roosevelt Road,Taipei10617,Taiwan,ROC

Received6September2004;received in revised form5April2005;accepted11April2005

Available online10May2005

Abstract

Three degenerate primers,located at the NIb and CP gene regions,were designed for potyvirus detection.Using these primer pairs, 1.0–1.2kb cDNA fragments of the3 -terminal region of six potyviruses were successfully amplified from infected plant tissues.RT-PCR products were sequenced and found to be derived from the expected viruses.To identify further these potyviruses,sequences located between the3 end of the NIb gene and the5 end of the CP gene were chosen to design a series of species-specific probes.The probes were prepared by PCR with species-specific primers,immobilized onto nylon membrane,and then hybridized with DIG-labeled RT-PCR products amplified by potyvirus degenerate primers.The results suggested that species-specific cDNA probes plus reverse dot blot hybridization was able to identify correctly different species of potyviruses in single as well as mixed infections.

©2005Elsevier B.V.All rights reserved.

Keywords:Potyvirus;Degenerate primer;RT-PCR;cDNA probe;Reverse dot blot hybridization;Identification

1.Introduction

The genus Potyvirus(in the family Potyviridae)contains the largest number of plant virus species,including91 formal species and88tentative species(van Regenmortel et al.,2000).Potyviruses cause significant losses in a wide range of crop plants and are transmitted by aphids in a non-persistent manner.Virions of potyviruses areflexuous filaments,680–900nm long and11–13nm wide.The single-stranded,positive-sense RNA genome of potyviruses (ca.10kb)is polyadenylated at the3 end and has a viral genome-linked protein(VPg)covalently linked to the5 end.The whole genome encodes a single polyprotein subse-quently processed into9–10proteins by three virus-encoded proteinases(van Regenmortel et al.,2000).

Since the1970s,serological methods especially enzyme-linked immunosorbent assay(ELISA)have been used widely and successfully for detection of plant viruses and diagnosis of plant viral diseases(Clark and Adams,1977;Flegg and ∗Corresponding author.Tel.:+886233665209;fax:+886223620271.

E-mail address:ycchang@ntu.edu.tw(Y.-C.Chang).Clark,1979).In the1990s,nucleic acid-based methods such as reverse transcription(RT)and the polymerase chain reac-tion(PCR)began to be used in plant virus detection(Wetzel et al.,1991;Rowhani et al.,1995;Thomson and Dietzgen, 1995).Accordingly,several degenerate primers have been de-signed to recognize the conserved regions of viral genomes of many virus species or the whole virus genus or family (Langeveld et al.,1991;Bateson and Dale,1995;Tian et al.,1996;Gibbs and Mackenzie,1997;Chen et al.,2001; Posthuma et al.,2002).Combining the RT-PCR technique and degenerate primers,it is possible to detect many virus species of the same genus or family in a single test,but it cannot distinguish the virus species.Currently,rapid iden-tification of a plant virus is based on ELISA,RT-PCR with specific primers,or cloning and sequencing methods.These investigations are facilitated when some information about the target virus(es)is available.

To overcome this requirement,a new method was devel-oped to identify different potyviruses in a single test,by a method similar to gene or mRNA detection using microar-rays(Gerhold et al.,1999;Harrington et al.,2000;Kane et al., 2000;Lockhart and Winzeler,2000).Species-specific probes

0166-0934/$–see front matter©2005Elsevier B.V.All rights reserved. doi:10.1016/j.jviromet.2005.04.002Y.-C.Hsu et al./Journal of Virological Methods128(2005)54–6055

were immobilized onto nylon membrane,and the virus could then be identified by reverse dot blot hybridization(L´e vesque et al.,1998;Martin et al.,2000)using the DIG-labeled RT-PCR product amplified from the infected tissue.Experimen-tal results demonstrated that this method has the potential to identify the species of potyviruses in single and mixed infec-tions.

2.Materials and methods

2.1.Virus sources

Six different potyviruses,one cucumovirus,one po-texvirus,one carmovirus and one tobamovirus were used in this study.A potato isolate of Potato virus Y(PVY) and a radish isolate of Turnip mosaic virus(TuMV)were kindly supplied by Dr.Tso-Chi Yang(Taiwan Seed Improve-ment and Propagation Station,Council of Agriculture)as dehydrated infected leaf tissues and were inoculated and maintained in Nicotiana tabacum var.Samsun and radish (Raphanus sativus),respectively.The remaining viruses are collections in our laboratory.ZAN isolate of Dasheen mosaic virus(DsMV)and ZAN isolate of Zantedeschia mosaic virus (ZaMV)(Chang et al.,2001)originally from calla lily(Zant-edeschia spp.)were separately maintained in Philodendron selloum.A papaya isolate of Papaya ringspot virus(PRSV) and a loofah isolate of Zucchini yellow mosaic virus(ZYMV) collected from the experimental farm of National Taiwan University were maintained in papaya(Carica papaya)and zucchini squash(Cucurbita pepo),respectively.Cucumber mosaic virus(CMV)(isolated from New Guinea impatiens), Cymbidium mosaic virus(CymMV)(isolated from orchid), Hibiscus chlorotic ringspot virus(HCRSV)(isolated from hibiscus)and Tobacco mosaic virus(TMV)(isolated from tobacco)were maintained in N.benthamiana for CMV and TMV,in orchid(Phalaenopsis spp.)in the case of CymMV and in kenaf(Hibiscus cannabinus)in the case of HCRSV.

2.2.Plant total RNA extraction

Leaf tissue(100mg)was harvested and ground intofine powder in liquid nitrogen,and then transferred to a microfuge tube.Plant total RNAs were extracted from pulverized tis-sue,according to the protocol of plant total RNA extraction Miniprep system(Viogene,CA,USA).

2.3.Potyvirus degenerate primer design

The amino acid sequences of potyviruses were collected from the PIR and Swiss-Prot databases using LOOKUP program in SeqWeb(Accelrys Inc.,San Diego,CA, USA).Thirty-three sequences were aligned by PILEUP and PRETTY program in SeqWeb.Several conserved regions were found and the consensus sequence was transferred to the CODEHOP web site(http://blocks.fhcrc.org/blocks/Table1

Oligonucleotide primer sequences used in this study

Primer a Sequence b

Potyvirus degenerate primer

PNIbF15 GGBAAY AATAGTGGNCAACC3

PNIbF55 GCCAGCCCTCCACCGTNGTNGAY AA3 PCPR15 GGGGAGGTGCCGTTCTCDATRCACCA3 “Potyvirus”-F1primer

DsMV-F15 AAATGTGAAGGAGTGCGAACTTCA3 PRSV-F15 AGTAAGCGTGGGTCAATGGA3

PVY-F15 TGGATGAGGAAGAGCTGAGAG3 TuMV-F15 CCAGCTCAAGAAGATCTTACTC3 ZaMV-F15 TCGTGATGCTAATGAGGAGGAG3 ZYMV-F15 ACTGGCACGATACCTACAAGC3 “Potyvirus”-R1primer

DsMV-R15 AACTTCCTTGCCTTTCTCACTTG3 PRSV-R15 CTCTCCAGTTTTTGTGCTAGTTG3

PVY-R15 TGTTCGGGTTTGACTGGATGCT3 TuMV-R15 TCGCGTTCACCCTCTTCTTG3

ZaMV-R15 GTGTGTTTGCACTTGTTTGTTC3 ZYMV-R15 CTTGGCAGCTACTACTGTTTTC3

a F1and F5indicate forward primers,whereas R1indicates reverse primer.

b Nucleotide at degenerate positions are represented by a single letter code; R=A and G;Y=C and T;B=C,G and T;D=A,G and T;N=A,C,G and T.

codehop.html)(Rose et al.,1998).The consensus sequence wasfirst pasted on the multiple alignment processor as FASTA format,then it was reformatted into Blocks Database format by the multiple alignment processor.The Blocks were then used to design the degenerate primers with the tempera-ture setting at60◦C and the codon usage table setting at equal. For the degenerate primers located in the CP region,sev-eral suggested primers were obtained and one,which had the lowest degeneration,was selected as the reverse degenerate primer:PCPR1(Table1)coding for the conserved sequence WCIENGTSP(Fig.1).A similar approach was used to design degenerate primers to a conserved sequence in the NIb re-gion:PNIbF1and PNIbF5(Table1)encoding the sequences GNNSGQP and GQPSTVVDN,respectively(Fig.1).

2.4.RT-PCR amplification of viral RNA

For RT reaction,0.35␮g of plant total RNA and50pmol PCPR1primer were added into a microfuge tube,

incu-Fig.1.Schematic representation of the potyvirus genome,showing the rel-ative positions of primers and probes.The positions of potyvirus degenerate primers are shown by triangles,those of species-specific primers and probes are shown by arrows and thick lines,respectively.The corresponding posi-tions and amino acid sequences of degenerate primers are also indicated.56Y.-C.Hsu et al./Journal of Virological Methods128(2005)54–60

bated at65◦C for10min and then kept on ice for5min. The cDNA synthesis reaction was carried out in a total vol-ume of50␮l using AMV reverse transcriptase(Promega, WI,USA),according to the manufacture’s instructions.PCR reactions contained2␮l of RT product,5pmol PCPR1 primer,5pmol PNIbF1or PNIbF5primer,4nmol dNTPs, 1U DyNAzyme TM II DNA polymerase(Finnzymes Inc., Finland),1X DyNAzyme TM II DNA polymerase buffer in a total volume of20␮l.The PCR reaction was carried out using GeneAmp®PCR system2400or9700(Perkin-Elmer Applied Biosystems,CA,USA)and an initial incubation at 94◦C for5min was followed by35cycles at94◦C for30s, 55◦C for45s and72◦C for1min,and afinal incubation at 72◦C for7min.

2.5.Cloning and sequencing of cDNA fragments of different potyviruses

RT-PCR products derived from each potyvirus were exam-ined in1%agarose gel and purified by GFX TM PCR DNA and Gel Band Purification Kit(Amersham Pharmacia Biotech, NJ,USA).The products were cloned into the pGEM-T®Easy vector(Promega,WI,USA).The ligation reaction was set up as suggested by the technical manual,and the products were used to transform Escherichia coli DH5␣.Recombinant colonies were detected by blue-white selection(Sambrook and Russell,2001)and colony PCR.

All clones were sequenced using the ABI PRISM®BigDye TM terminator cycle sequencing ready reaction kit (Perkin-Elmer Applied Biosystems,CA,USA)and T7 and SP6primers separately.The sequencing PCR reac-tion was carried out according to the manufacturer,and clones were sequenced using the ABI PRISM®310ge-netic analyzer(Perkin-Elmer Applied Biosystems,CA, USA).

2.6.Sequence analysis

Sequence analysis was undertaken using the Wisconsin GCG package version10.3and SeqWeb version1.2(Ac-celrys Inc.,San Diego,CA,USA).The sequences were as-sembled by the Fragment Assembly System(FAS)and an-alyzed through similarity search by BLAST and FASTA programs in Wisconsin package.The amino acid sequences were aligned using the PILEUP and PRETTY programs in SeqWeb.

2.7.Species-specific probe preparation and immobilization

The amino acid sequences of the NIb and CP of the six potyviruses were aligned to facilitate the design of species-specific primer pairs for each of the six potyviruses(Table1). The primers were located in a variable region between the3 end of the NIb gene and the5 end of the CP gene(Fig.1). Species-specific probes for each virus were prepared by PCR amplification of the corresponding viral cDNA clone.Two probes were prepared for each virus,both contained this variable region.The“potyvirus”-P2probes(Fig.1)started from the species-specific forward primer(“potyvirus”-F1, Table1)and ended at PCPR1primer;their sizes ranged from466to600bp.Whereas,the“potyvirus”-P3probes (Fig.1)started from the species-specific forward primer but ended at the species-specific reverse primer(“potyvirus”-R1,Table1).Probe sizes ranged between171and 313bp.

After gel electrophoresis,the concentration of each probe was measured by the Kodak Digital Science TM1D image analysis software(Eastman Kodak Company,NY,USA), and then adjusted to10ng/␮l before application.The probes were denatured at94◦C for10min,and then chilled on ice for5min.Probes(0.5␮l)were transferred to the nylon membrane,the membrane was air-dried,and then UV cross-linking was carried out to immobilize the probes.

2.8.Target preparation and labeling

The targets were prepared from total RNA and labeled dur-ing the PCR.RT-PCR of plant total RNA was performed with PCPR1/NIbF1or PCPR1/NIbF5primers as described previ-ously except200␮M dNTPs was substituted by1×PCR DIG labeling mix(Roche Applied Science,Mannheim,Ger-many).The concentration of targets was adjusted to6ng/␮l before use.

2.9.Reverse dot blot hybridization

The nylon membrane was prehybridized with freshly prepared hybridization solution[50%formamide,5×SSC (v/v),2%blocking reagent(w/v)(Roche Applied Sci-ence,Mannheim,Germany),0.1%N-lauroylsarcosine(w/v), 0.02%SDS(w/v)]at50◦C for at least1h.The target was denatured at96◦C for10min,and chilled on ice for5min before the addition of1–5␮l target per10ml hybridization solution.Hybridization was performed at50◦C for at least 6h,after which,the membrane was washed in2×SSC,0.1% SDS for5min at room temperature twice.The membrane was then washed in0.1×SSC,0.1%SDS for15min at68◦C twice.The membrane could be used directly for detection or air-dried for storage.

The membrane was washed briefly in buffer1(0.1M maleic acid,0.15M NaCl,pH7.5),and then incubated in buffer2(1%blocking reagent in buffer1)at room tempera-ture for30min.The membrane was incubated in20ml diluted antibody-conjugate(Roche Applied Science,Mannheim, Germany;diluted to75mU/ml in buffer2)at room tempera-ture for30min.After incubation,the membrane was washed in buffer1at room temperature for15min twice and then in-cubated in1ml CDP-Star solution(Roche Applied Science, Mannheim,Germany)at room temperature for15min.The fluorescent signal was detected by sealing the membrane and exposing on X-rayfilm.

Y.-C.Hsu et al./Journal of Virological Methods 128(2005)54–6057

3.Results

3.1.Specificity of potyvirus degenerate primers

In order to evaluate the specificity of potyvirus degenerate primers,five viruses belonging to different genus or family were used in RT-PCR tests.Total RNAs were extracted from each virus-infected plants and analyzed by RT-PCR with two pairs of potyvirus degenerate primers,PCRR1/PNIbF1and PCPR1/PNIbF5(Table 1and Fig.1).These primers corre-sponded to the conserved sequences located in the NIb and CP regions,and should react theoretically with all of the po-tyviruses to give a 1.0–1.2kb cDNA product.Accordingly,these primers only generated a specific 1.0-kb RT-PCR prod-uct with ZaMV (potyvirus),they did not amplify any specific product with CMV (cucumovirus),CymMV (potexvirus),HCRSV (carmovirus)and TMV (tobamovirus)(Fig.2).

The

Fig.2.Specificity of potyvirus degenerate primers by RT-PCR assays on total RNA of different virus-infected plants.Lane 1,1kb Plus DNA Ladder (Invitrogen,CA,USA);lane 2,positive control (cDNA clone of ZaMV);lane 3,CMV-infected Nicotiana benthamiana ;lane 4,CymMV-infected orchid (Phalaenopsis sp.);lane 5,HCRSV-infected kenaf (Hibiscus cannabinus );lane 6,TMV-infected N.benthamiana ;lane 7,ZaMV-infected Philodendron selloum .The RT primer was PCPR1,and two pairs of potyvirus degenerate primers,PCPR1and PNIbF1(panel A)and PCPR1and PNIbF5(panel B),were used in PCR.The 1.0-kb RT-PCR products of ZaMV identified by 1%agarose gel electrophoresis are indicated by the

arrows.

Fig.3.Different potyviruses detected by RT-PCR and potyvirus degenerate primers.Total RNA of potyvirus-infected plants was extracted and analyzed.The RT primer was PCPR1.The PCR primer pair used to detect PRSV and TuMV was PCPR1/PNIbF1,and the size of the RT-PCR fragment was about 1.2kb.The PCR primer pair used to detect DsMV ,PVY ,ZaMV and ZYMV was PCPR1/PNIbF5,and the size of the RT-PCR fragment was about 1.0kb.The left lane of every panel is 1kb Plus DNA Ladder (Invitrogen,CA,USA).RT-PCR products were analyzed in 1%agarose gel.

0.3-kb cDNA fragments amplified from CMV-and TMV-infected plant total RNAs by PCRR1/PNIbF1(Fig.2A)were the nonspecific products of N.benthamiana after verified by cloning and sequence analysis (data not shown).The re-sult indicated that these potyvirus degenerate primers had satisfactory specificity because they did not react with non-potyviruses.

3.2.Virus detection and cDNA cloning

To confirm further the application spectrum of these de-generate primers,six different potyviruses were detected separately in inoculated propagation hosts by RT-PCR us-ing PCPR1as the RT primer and subsequently using PCPR1/PNIbF1or PCPR1/PNIbF5as PCR primers.The expected band on the agarose gel after RT-PCR amplifica-tion was about 1.0–1.2kb.PRSV and TuMV had RT-PCR products about 1.2kb amplified by PCPR1/PNIbF1primers (Fig.3).DsMV ,PVY ,ZaMV and ZYMV had RT-PCR products about 1.0kb amplified by PCPR1/PNIbF5primers (Fig.3).In addition,all RT-PCR products were derived from the expected viruses,as confirmed by sequence analysis af-ter cDNA cloning.Accordingly,these potyvirus degenerate primers have the potential to detect the members of the genus Potyvirus .

3.3.Specificity of the species-specific cDNA probes Degenerate primers together with RT-PCR can only de-tect potyvirus,but cannot identify the species of the virus detected.To overcome this constraint,a new identification method using the species-specific probes and reverse dot blot hybridization was developed.Two types of cDNA probes were prepared for each potyvirus by PCR amplification.The “potyvirus”-P2probes started from “potyvirus”-F1primer

and ended at PCPR1primer.Whereas,the“potyvirus”-P3 probes started from“potyvirus”-F1primer and ended at “potyvirus”-R1primer(Table1and Fig.1).The specificity of the species-specific probes was evaluated by dot blot hy-bridization.The PCR fragments of each virus clone ampli-fied by PCPR1and PNIbF1were applied to a nylon mem-brane.The DIG-labeled species-specific probes were used for hybridization.The result showed that cross-hybridization was observed in PCR fragments with the P2probes of PRSV,PVY,TuMV and ZYMV(Fig.4,left panel).But nonspecific hybridization was found only in the P3probes of PRSV(Fig.4,right panel).The P3probes have better specificity than that of the P2probes according to dot blot hybridization.

3.4.Virus identification by reverse dot blot hybridization

Next,these species-specific cDNA probes and revere dot blot hybridization were tested for identifying differ-ent potyviruses from infected tissues in a single test.At first,5ng of unlabeled P2and P3probes were immobi-lized onto a nylon membrane and each probe had a du-plicate(Fig.5A).The reverse dot blot hybridizations

were Fig.4.Specificity of potyvirus species-specific probes by dot blot hybridiza-tion.PCR fragments of each virus clone were amplified by PCPR1and PNIbF1primers and immobilized on nylon membranes.Dot1,DsMV;dot 2,PRSV;dot3,PVY;dot4,TuMV;dots5and6,ZaMV;dots7and8, ZYMV.Blots were separately hybridized with different P2probes(left pan-els)or P3probes(right panels).One microliter of individual PCR fragments and probes were used in dot blot hybridization.

performed by hybridizing with6ng of the DIG-labeled tar-gets which were RT-PCR amplified from the infected plant total RNA by potyvirus degenerate primers.The immobi-lized probes recognized correctly all of the viruses

tested, Fig.5.Identification of DsMV,PRSV,PVY,TuMV,ZaMV and ZYMV by reverse dot blot hybridization.PCPR1was used as RT primer for total RNA of plants infected by different potyviruses.Subsequent PCR was used to DIG-label the targets using the primers PCPR1/PNIbF1or PCPR1/PNIbF5.(A)The arrangement of the unlabeled immobilized probes on the nylon membrane.(B)Results of reverse dot blot hybridization of DsMV,PRSV,PVY,TuMV,ZaMV and ZYMV,respectively.Targets were amplified with primers PCPR1/PNIbF1(left panel)or PCPR1/PNIbF5(right panel).Five nanogram of each probe and 6ng of each target were used in reverse dot blot hybridization.Y.-C.Hsu et al./Journal of Virological Methods128(2005)54–60

59

Fig.6.Identification of potyviruses in artificially and naturally mixed in-fection samples by reverse dot blot hybridization.Total RNAs from plants separately infected by PRSV and ZYMV were mixed together and then per-formed reverse dot blot hybridization(panel A).Total RNAs extracted from the plant simultaneously infected by TuMV and ZaMV were also assayed by the same method(panel B).PCPR1was used as RT primer for both sam-ples.Subsequent PCR was used to DIG-label the targets using the primers PCPR1/PNIbF1or PCPR1/PNIbF5.The arrangement of the unlabeled im-mobilized probes on the nylon membrane was the same as Fig.5A.Five nanogram of each probe and30ng of each target were used in reverse dot blot hybridization.

including DsMV,PRSV,PVY,TuMV,ZaMV and ZYMV,ir-respective of whether target fragments were amplified with PCPR1/PNIbF1or PCPR1/PNIbF5primers(Fig.5B).Al-though the previous specificity test showed that the P2and P3probes might hybridize with undesired targets,cross-hybridization was not observed in these reverse dot blot hybridizations.

In order to test if this method could identify further differ-ent potyviruses in mixed infection,total RNAs extracted sep-arately from PRSV-and ZYMV-infected plants were mixed to mimic mixed infection sample before reverse dot blot hy-bridization was performed.Target fragments were amplified separately with PCPR1/PNIbF1and PCPR1/PNIbF5primers and subsequently hybridized with the blots as previously de-scribed.The result demonstrated that both kinds of targets prepared from the mixed total RNAs of PRSV-and ZYMV-infected plants could react with the P2and P3probes of both viruses(Fig.6A).Although the result was interesting,it was obtained from a sample mixed artificially.For that reason, a natural mixed infection sample of calla lily was searched since not only DsMV and ZaMV(Chang et al.,2001)but also TuMV could infect calla lily(Chen et al.,2003).Fortunately, a plant infected simultaneously by ZaMV and TuMV was screened by ELISA.This material was used for the prepa-ration of the targets and then hybridized with the blots as before.Since two pairs of primers gave similar results,only the result obtained with PCPR1/PNIbF1primers was shown. The result indicated that the targets from the mixed infection plant could hybridize with both ZaMV and TuMV cDNA probes although the signals of P3probes were weaker than those of P2probes(Fig.6B).These results indicate that this method has the potential to identify the species of potyviruses in mixed infections accurately.4.Discussion

An RT-PCR based method,which has the potential to de-tect members of the genus Potyvirus by using new designed potyvirus degenerate primers,was developed.Since the amino acid sequence GNNSGQPSTVVDN is highly con-served among potyviruses,the primers PNIbF1and PNIbF5 that are derived from the5 and3 region of this coding se-quence should amplify any potyvirus,however,more exper-iments are needed to confirm this possibility.Although sim-ilar methods have been described previously by Langeveld et al.(1991),Gibbs and Mackenzie(1997)and Chen et al. (2001),the procedure used in this study was different since two primer pairs were used to avoid false negative results.Ac-cordingly,a potyvirus should be amplified from the RT-PCR method resulting in a product of1.0–1.2kb,depending on the size of the5 terminus of the CP gene and also the3 terminus of the NIb gene,but no specific amplification was observed with cucumovirus,carmovirus,potexvirus and tobamovirus (Fig.2).Furthermore,using the PCPR1potyvirus degenerate primer,rather than a dT primer,as the reverse primer for the RT-PCR can avoid the potential problem of interaction with plant poly(A)+mRNAs.In fact,the PCPR1primer always produced fewer nonspecific fragments in preliminary assays (data not shown).The experimental results demonstrated that this method could detect successfully the existence of twelve different potyviruses from the infected plant tissues in addition to DsMV,PRSV,PVY,TuMV,ZaMV and ZYMV (data not shown).Therefore,this RT-PCR method can be used as a rapid detection method for potyviruses.

It is theoretically possible by combining RT-PCR and de-generate primers to detect every member in the genus Po-tyvirus,however,there are limitations in such an approach: since it can neither identify the species of the detected virus(es)nor distinguish single infection from mixed infec-tion.As further identification may be needed,another identi-fication method has been developed.This method adopted the concept of microarray using species-specific probes and re-verse dot blot hybridization(L´e vesque et al.,1998)to identify the virus(es)directly from infected plant tissues.Recently, Lee et al.(2003)developed a cucurbit-virus chip to detect four tobamoviruses from extracted total RNAs and Boonham et al.(2003)showed the possibility of identifying four potato viruses by microarray technology.

To determine the influence of probe sequence,two sets of species-specific cDNA probes,P2and P3,were designed. During the specificity tests of the probes,the P2probes hy-bridized frequently with other undesired targets,but the P3 probes seldom acted in such way(Fig.4).This may be due to the P2probes covering some conserved sequences of the CP gene,whereas P3probes only represent for the variable region between the NIb and CP genes(Fig.1).Therefore, it was assumed that the P2probes would still have cross-hybridization in the reverse dot blot hybridization.Surpris-ingly,the results showed that such problems could be solved by using the reverse dot blot hybridization approach as the

60Y.-C.Hsu et al./Journal of Virological Methods128(2005)54–60

P2probes had the same specificity as the P3probes by this assay(Fig.5).The reason why dot blot and reverse dot blot had a different specificity may be due to different percent-ages of conserved sequences were labeled for detection.In other words,the labeled targets in reverse dot blot hybridiza-tion had a lower proportion of conserved sequences than the labeled P2probes in dot blot hybridization and thus these targets did not hybridize with nonhomologus probes.In ad-dition,the experimental results of total RNA derived from potyvirus-infected tissues(Figs.5and6)indicated that this method could identify correctly potyvirus(es)in single as well as in mixed infections.

In this study a detection method which can examine whether a plant is infected by potyviruses and an identifi-cation method which is capable of identifying species of potyviruses occurring in plant tissues were developed.There-fore,it is possible to identify new hosts of known potyvirus such as TuMV-infected calla lily by these methods.As long as more potyvirus samples become available and the species-specific probes for every potyvirus are generated,a complete identification chip(blot)for potyviruses may be obtained in the near future.This novel method will speed up the identifi-cation procedure for potyviruses in infected plants.However, most importantly is that this new combination of RT-PCR and reverse dot blot hybridization can be applied to other viruses. Acknowledgements

We thank Dr.Chao-Wen Wang for critically reviewing the manuscript.This study was supported by grants(91AS-7.2.2-BQ-B4and92AS-1.8.2-BQ-B4)from the Bureau of Animal and Plant Health Inspection and Quarantine,the Council of Agriculture,Executive Yuan,Taiwan,the Republic of China. References

Bateson,M.F.,Dale,J.L.,1995.Banana bract mosaic virus,characteri-zation using potyvirus specific degenerate PCR primers.Arch.Virol.

140,515–527.

Boonham,N.,Walsh,K.,Smith,P.,Madagan,K.,Graham,I.,Barker,

I.,2003.Detection of potato viruses using microarray technology:

towards a generic method for plant viral disease diagnosis.J.Virol.

Methods108,181–187.

Chang,Y.C.,Chen,Y.L.,Chung, F.C.,2001.Mosaic disease of calla lily caused by a new potyvirus in Taiwan.Plant Dis.85, 12.

Chen,J.,Chen,J.,Adams,M.J.,2001.A universal PCR primer to de-tect members of the Potyviridae and its use to examine the taxo-nomic status of several members of the family.Arch.Virol.146,757–766.

Chen,C.C.,Chao,C.H.,Chen,C.C.,Yeh,S.D.,Tsai,H.T.,Chang,C.A., 2003.Identification of Turnip mosaic virus isolates causing yellow stripe and spot on calla lily.Plant Dis.87,901–905.Clark,M.F.,Adams,A.N.,1977.Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses.J.Gen.Virol.34,475–483.

Flegg,C.L.,Clark,M.F.,1979.The detection of apple chlorotic leafspot virus by a modified procedure of enzyme-linked immunosorbent assay (ELISA).Ann.Appl.Biol.91,61–65.

Gerhold,D.,Rushmore,T.,Caskey,C.T.,1999.DNA chips,promising toys have become powerful tools.Trends Biochem.Sci.24,168–173. Gibbs,A.,Mackenzie,A.,1997.A primer pair for amplifying part of the genome of all potyvirids by RT-PCR.J.Virol.Methods63,9–16. Harrington,C.A.,Rosenow,C.,Retief,J.,2000.Monitoring gene expres-sion using DNA microarrays.Curr.Opin.Microbiol.3,285–291. Kane,M.D.,Jatkoe,T.A.,Stumpf,C.R.,Lu,J.,Thomas,J.D.,Madore, S.J.,2000.Assessment of the sensitivity and specificity of oligonu-cleotide(50mer)microarrays.Nucleic Acids Res.28,4552–4557. Langeveld,S.A.,Dore,J.M.,Memelink,J.,Derks,A.F.L.M.,van der Vlugt,C.I.M.,Asjes,C.J.,Bol,J.F.,1991.Identification of potyviruses using the polymerase chain reaction with degenerate primers.J.Gen.

Virol.72,1531–1541.

Lee,G.P.,Min,B.E.,Kim,C.S.,Choi,S.H.,Harn,C.H.,Kim,S.U., Ryu,K.H.,2003.Plant virus cDNA chip hybridization for detection and differentiation of four cucurbit-infecting Tobamoviruses.J.Virol.

Methods110,19–24.

L´e vesque,C.A.,Harlton,C.E.,de Cock,A.W.A.M.,1998.Identification of some oomycetes by reverse dot blot hybridization.Phytopathology 88,213–222.

Lockhart,D.J.,Winzeler,E.A.,2000.Genomics,gene expression and DNA arrays.Nature405,827–836.

Martin,R.R.,James,D.,L´e vesque,C.A.,2000.Impacts of molecular di-agnostic technologies on plant disease management.Annu.Rev.Phy-topathol.38,207–239.

Posthuma,K.I.,Adams,A.N.,Hong,Y.,Kirby,M.J.,2002.Detection of Strawberry crinkle virus in plants and aphids by RT-PCR using conserved L gene sequences.Plant Pathol.51,266–274.

Rose,T.M.,Schultz, E.R.,Henikoff,J.G.,Pietrokovski,S.,McCal-lum,C.M.,Henikoff,S.,1998.Consensus-degenerate hybrid oligonu-cleotide primers for amplification of distantly related sequences.Nu-cleic Acids Res.26,1628–1635.

Rowhani,A.,Maningas,M.A.,Lile,L.S.,Daubert,S.D.,Golino,D.A., 1995.Development of a detection system for viruses of woody plants based on PCR analysis of immobilized virions.Phytopathology85, 347–352.

Sambrook,J.,Russell,D.W.,2001.Molecular Cloning,A Laboratory Manual…third ed.Cold Spring Harbor Laboratory Press,Cold Spring Harbor,New York,USA.

Thomson,D.,Dietzgen,R.G.,1995.Detection of DNA and RNA plant viruses by PCR and RT-PCR using a rapid virus release protocol without tissue homogenization.J.Virol.Methods54,85–95. Tian,T.,Klaassen,V.A.,Wisler,G.,Duffus,J.E.,Falk,B.W.,1996.Gener-ation of cDNAs specific to lettuce infectious yellows closterovirus and other whitefly-transmitted viruses by RT-PCR and degenerate oligonu-cleotide primers corresponding to the closterovirus gene encoding the heat shock protein70homolog.Phytopathology86,1167–1173. van Regenmortel,M.H.V.,Fauquet,C.M.,Bishop,D.H.L.,Carstens,E.B., Estes,M.K.,Lemon,S.M.,Maniloff,J.,Mayo,M.A.,McGeoch,D.J., Pringle,C.R.,Wickner,R.B.,2000.Virus taxonomy:classification and nomenclature of viruses.In:Seventh Report of the International Committee on Taxonomy of Viruses,Academic Press,San Diego, 1162p.

Wetzel,T.,Candresse,T.,Ravelonandro,M.,Dunez,J.,1991.A poly-merase chain reaction assay adapted to plum pox potyvirus detection.

J.Virol.Methods33,355–365.下载本文